Journal: bioRxiv

Article Title: DNA polymerase stalling at structured DNA constrains the expansion of Short Tandem Repeats

doi: 10.1101/2020.06.20.162743

Figure Lengend Snippet: (a) Overview of the high-throughput primer extension assay used to monitor DNA synthesis at designed sequences. A library of 20,000 sequences comprising all STR permutations at three different lengths together with control structured DNA sequences was synthesised on a programmable microarray, eluted and inserted into a phagemid vector. After PCR amplification, insertion into a phagemid vector and bacterial amplification, circular single-stranded DNA templates were produced using a M13KO7 helper phage. Fluorescently labelled primer (P3) and structures annealing were performed before initiating DNA synthesis through the addition of T7 DNA polymerase. Primers are then either fully extended to the length of the circular template or the extension is stopped within STRs if the DNA polymerases stall at structured DNAs. (b) Extended and stalled products were then analysed by denaturing Poly Acrylamide Gel (PAGE) electrophoresis, recovered from the gel matrix and prepared for high throughput sequencing. DNA polymerase stalling was then quantified by analysing the enrichment of each sequence form the library in the stalled and extended fractions. Representative fluorescence gel imaging of primer extension reactions on templates containing a G-quadruplex (G4) structure, a mutated G4 or the entire DNA library, stopped after the indicated times, are reported for comparison. Blue and red arrows indicate the position of the extended and stalled products respectively. The green line highlights the presence of transient stall sites that disappear overtime.

Article Snippet: Primer extension reactions were performed using a modified T7 DNA polymerase (SequenaseTM Version 2.0, Thermofisher) and a Cy5-labeled primer (P3: 5’-Cy5-TAATGTGAGTTAGCT-3’) annealing to the 3098 nt ssDNA templates and 230 nt from the start of the STRs or designed structures.

Techniques: High Throughput Screening Assay, Primer Extension Assay, DNA Synthesis, Control, Microarray, Plasmid Preparation, Amplification, Produced, Acrylamide Gel Assay, Electrophoresis, Next-Generation Sequencing, Sequencing, Fluorescence, Imaging, Comparison

Journal: bioRxiv

Article Title: DNA polymerase stalling at structured DNA constrains the expansion of Short Tandem Repeats

doi: 10.1101/2020.06.20.162743

Figure Lengend Snippet: Distribution and density plots of the computed stall scores associated to the (a) G4-, (b) hairpin-forming control sequences and (c) all STR permutations at different time points showing time-dependent DNA polymerase stalling at DNA structures. (d) Example of time-dependent variation of stall scores associated to a G4 ( GGGG ACA GGGGGG AC GGGG CTTGAAAT GGGG, blue points) or a hairpin ( TACGGTATAATTAAGGACGTAT TTTT ACGTCCTTAATTATACCGTA, red points) structure. The kinetic constants associated with DNA synthesis ( λ ) together with their associated coefficients of determination ( R 2 ) were extracted by fitting the experimental data using either an exponential growth or decay functions. Error bars represent the standard deviation from two independent replicates. (e) Similar analysis performed on two representative STRs, the GTGGGT and AAGTTT sequences repeated 8 times, highlighting transient or persistent stalling at STRs. (f) Distribution of the kinetic constants of DNA synthesis associated with the control sequences, e . g . random sequences of varying GC content (control), hairpins, i-motifs and G4s; and all STR permutations. λ values associated with the hairpins, i-motifs and G4s are for structured sequences that have a stall score statistically higher than the random control sequences at each time point. Centre lines denote medians, boxes span the interquartile range, and whiskers extend beyond the box limits by 1.5 times the interquartile range. P values for the comparison of the distributions were calculated using Kolmogorov–Smirnov tests, *** P < 0.001.

Article Snippet: Primer extension reactions were performed using a modified T7 DNA polymerase (SequenaseTM Version 2.0, Thermofisher) and a Cy5-labeled primer (P3: 5’-Cy5-TAATGTGAGTTAGCT-3’) annealing to the 3098 nt ssDNA templates and 230 nt from the start of the STRs or designed structures.

Techniques: Control, DNA Synthesis, Standard Deviation, Comparison

Journal: bioRxiv

Article Title: DNA polymerase stalling at structured DNA constrains the expansion of Short Tandem Repeats

doi: 10.1101/2020.06.20.162743

Figure Lengend Snippet: (a) Distribution together with the statistical relevance of averaged computed stall scores at 0.5 min for the 964 unique single-stranded STR motifs when 48 nucleotides long together with their structures predicted using a supervised machine-learning algorithm. The Q values are computed by combining P values associated to the statistical differences in stall scores at all time points observed for a given STR motif and the random control sequences of varying GC content (see Methods details) and reflect that DNA polymerase stalling at STRs is structure rather than sequence dependent. Distribution of stall scores at (b) 0.5 min and (c) 30 min associated with the different structural classes of STRs of any length, highlighting the transient or persistent nature of DNA polymerase stalling at hairpin-like and tetrahelical STR respectively. (d) Fraction of predicted structured STRs as a function of STR length highlighting length-dependent structure formation. (e) Distribution of stall scores at 30 min associated with each structural class and in function of STR length. The reported structures are those predicted when the STRs are 72 nt long. Centre lines denote medians, boxes span the interquartile range, and whiskers extend beyond the box limits by 1.5 times the interquartile range. P values for the comparison of the distributions were calculated using Kolmogorov–Smirnov tests, n.s P > 0.05, * P ≤ 0.05, ** P < 0.01, *** P < 0.001. (f) Hierarchical clustering of STR single-stranded motifs by sequences using cosine distances as measure of sequence similarity together with heatmaps reporting GC content and sequence entropy. The leaves of the dendrogram are coloured according to the predicted structures of the STRs. Such representation highlights two distinct families related to G4 (red) and i-motifs (green) forming STRs. Hairpin-like STRs are dispersed over the dendrogram showing a higher degree of sequence diversity.

Article Snippet: Primer extension reactions were performed using a modified T7 DNA polymerase (SequenaseTM Version 2.0, Thermofisher) and a Cy5-labeled primer (P3: 5’-Cy5-TAATGTGAGTTAGCT-3’) annealing to the 3098 nt ssDNA templates and 230 nt from the start of the STRs or designed structures.

Techniques: Control, Sequencing, Comparison

Journal: bioRxiv

Article Title: DNA polymerase stalling at structured DNA constrains the expansion of Short Tandem Repeats

doi: 10.1101/2020.06.20.162743

Figure Lengend Snippet: Deep sequencing of the stalled products of replication allows DNA synthesis to be followed over time and the mapping of stalled DNA polymerase at single nucleotide resolution. (a) Plotting the relative reads coverage at STRs, e . g . the 72 nt long ACGT and AAGGG repeats folding into hairpin-like and G4 structures respectively, reveals time-dependent sharp transitions corresponding to the main positions where the DNA polymerase stalls and dissociates during DNA synthesis. Computing the distance of the stalling sites, i . e . the mid-transition value, from the start of the repeat for each STR at different time points shows that the distance travelled by the polymerase after 30 min depends on (b) the stall scores of the STR and (c) their structures. 72 nt long STRs were binned either according to low (σ < 0.33), medium (0.33 ≤ σ < 0.66) and high (σ ≥ 0.66) stall scores at 30 min in (b) or to their predicted structures in (c) . Deep sequencing of the extended products of replication allows the identification of new sequence variants within the pool of newly synthesised DNA molecules. Mutations were classified into either base substitutions (BS) or expansion/contraction events (EC). (d) Distribution of the stall scores at 30 min associated to STRs presenting either expansion/contraction (orange) or base substitutions (light blue) events. (e) Pie charts representing the proportion of STR folding into hairpin-like (blue), i-motifs (green) or G4s structures (red) or unfolded (grey) when considering all STRs (All), STRs marked by expansion/contraction (EC) or base substitutions (BS) events. These charts show a depletion and an enrichment of structured STRs within the pool of STRs characterised by presenting either length or sequence variation respectively. Frequencies of (f) expansion/contraction and (g) base substitution events observed at STRs when binned according to their stall scores at 30 min (low: σ < 0.33, medium: 0.33 ≤ σ < 0.66, high: σ ≥ 0.66). Frequencies are defined as the ratios of the number of reads supporting a mutation by the total number of reads covering this mutation. Centre lines denote medians, boxes span the interquartile range, and whiskers extend beyond the box limits by 1.5 times the interquartile range. P values for the comparison of the distributions were calculated using Kolmogorov–Smirnov tests, * P ≤ 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Primer extension reactions were performed using a modified T7 DNA polymerase (SequenaseTM Version 2.0, Thermofisher) and a Cy5-labeled primer (P3: 5’-Cy5-TAATGTGAGTTAGCT-3’) annealing to the 3098 nt ssDNA templates and 230 nt from the start of the STRs or designed structures.

Techniques: Sequencing, DNA Synthesis, Mutagenesis, Comparison

Journal: bioRxiv

Article Title: DNA polymerase stalling at structured DNA constrains the expansion of Short Tandem Repeats

doi: 10.1101/2020.06.20.162743

Figure Lengend Snippet: After initiation of DNA synthesis (a) , if the DNA polymerase dissociates within an STR (b) , its repetitive nature may induce an out-of-register realignment (c) of the newly synthesised DNA on the template strand, leading to the expansion of the repeat according to a strand slippage mechanism. After several rounds of expansion, the STR may reach a threshold length at which the repeat will accommodate thermodynamically stable structures that would trigger polymerase stalling (d) and induce error-prone DNA synthesis (e) . Base substitution at the boundary of the structured STRs then dilute the repetitive sequences within the flanks of the STR locus. The length of the structured repeats at equilibrium therefore results from the balance of two processes: strand slippage and error-prone DNA synthesis regulated by polymerase stalling at DNA structures.

Article Snippet: Primer extension reactions were performed using a modified T7 DNA polymerase (SequenaseTM Version 2.0, Thermofisher) and a Cy5-labeled primer (P3: 5’-Cy5-TAATGTGAGTTAGCT-3’) annealing to the 3098 nt ssDNA templates and 230 nt from the start of the STRs or designed structures.

Techniques: DNA Synthesis

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: The RT-qPCR primers sequences.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques:

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: circRNA_102481 is significantly up-regulated in serum exosomes of patients with EGFR-TKIs resistance. ( A ) Hierarchical clustering analysis showed the top 10 most increased and increased circRNAs in serum exosomes. ( B ) RT-qPCR validation.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Quantitative RT-PCR, Biomarker Discovery

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: circRNA_102481 is mainly secreted via exosomes. ( A , B ) circRNA_102481 was unregulated in EGFR-TKIs resistant cells (PC9/GR and HCC827/ER), ** p < 0.01 versus matched sensitive cells (PC9 and HCC827). ( C , D ) circRNA_102481 was significantly up-regulated in exosomes of EGFR-TKIs resistant cells (PC9/GR and HCC827/ER), ** p < 0.01 versus matched sensitive cells (PC9 and HCC827).

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques:

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Exosomal circRNA_102481 derived from EGFR-TKIs resistance cells. ( A ) circRNA_102481 expression levels in exosomes were almost equal to those in CCM, but, the levels of circRNA_102481 expression in EGFR-TKIs-resistant cells were significantly higher than in CCM and exosomes, # p > 0.05, * p < 0.05. ( B ) RT-qPCR was performed to detect the expression level of circRNA_102481 after treatment with 1 μg/ml RNase alone or combined with 0.1% Triton X-100 for 30 min, # p > 0.05, * p < 0.05 compared to the PBS control. ( C ) Transfection efficiency of circRNA_102481 was verified by a confocal laser scanning microscope and RT-qPCR assay. ** P < 0.01 versus si-NC group cells. ( D ) circRNA_102481 was significantly down- regulated in exosomes of si-circRNA_ 102481 cells. * p <0.05, ** p <0.01 versus si-NC group exosomes. CCM: cell culture medium.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Derivative Assay, Expressing, Quantitative RT-PCR, Control, Transfection, Laser-Scanning Microscopy, Cell Culture

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Functional validation assay of circRNA_102481 on EGFR-TKIs resistant cells in vitro (n=3). ( A , B ) MTT assay showed the effects of circRNA_102481 on EGFR-TKIs resistant cell proliferation. ( C , D ) Annexin V/PI assay showed the effects of circRNA_102481 on EGFR-TKIs resistant cell apoptosis. si-circRNA_102481: siRNA targeting circRNA_102481. ** p <0.01 versus si-NC group.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Functional Assay, Biomarker Discovery, In Vitro, MTT Assay

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Functional validation assay of exosomes circRNA_102481 on EGFR-TKIs resistant cells in vitro (n=3). ( A , B ) MTT assay showed the effects of exosomes circRNA_102481 on EGFR-TKIs resistant cell proliferation. ( C , D ) Annexin V/PI assay showed the effects of exosomes circRNA_102481 on EGFR-TKIs resistant cell apoptosis. si-circRNA_102481: siRNA targeting circRNA_102481. * p <0.05 versus si-NC group.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Functional Assay, Biomarker Discovery, In Vitro, MTT Assay

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Functional validation assay of exosomes circRNA_102481 on EGFR-TKIs sensitive cells in vitro (n=3). ( A , B ) MTT assay showed the effects of circRNA_102481 on EGFR-TKIs sensitive cell proliferation. ( C , D ) Annexin V/PI assay showed the effects of circRNA_102481 on EGFR-TKIs sensitive cell apoptosis. circRNA_100859 vector: circRNA_100859 overexpression vector. * p <0.05 versus blank vector group.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Functional Assay, Biomarker Discovery, In Vitro, MTT Assay, Plasmid Preparation, Over Expression

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: circRNA_102481 serves as a miR-30a-5p sponge to regulate ROR1 expression. The detailed potential binding sequences of circRNA_102481 to miR-30a-5p ( A ) and ROR1 to miR-30a-5p ( D ). miR-30a-5p of PC9/GR and HCC827/ER cells was abundantly pulled down by circRNA_102481 ( B ) or ROR1 ( E ). Dual-luciferase reporter assay confirmed that miR-30a-5p competitively targeted circRNA_102481( C ), and that ROR1 is a direct target of miR-30a-5p ( F ). # p > 0.05, * p < 0.05, ** p <0.01.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Expressing, Binding Assay, Luciferase, Reporter Assay

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Effects of exosomes on circRNA_102481-miR-30a-5p-ROR1 Axis. ( A , B ) RT-qPCR assay showed miR-30a-5p expression in PC9/GR or HCC827/ER cells of si-NC and si-circRNA_102481 groups. ( C ) Transfection efficiency of miR-30a-5p mimic and miR-30a-5p inhibitor was verified by RT-qPCR assay. ** p <0.01 versus miR-30a-5p NC group cells. ( D , E ) qRT-PCR demonstrated that ROR1 mRNA expression were significantly decreased in miR-30a-5p mimic group, and increased in miR-30a-5p inhibitor group. * p <0.05, ** p <0.01 versus miR-30a-5p NC group.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Quantitative RT-PCR, Expressing, Transfection

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Effects of exosomes on circRNA_102481-miR-30a-5p-ROR1 Axis. ( A , B ) Relative ROR1 mRNA and protein were analyzed in PC9/GR and HCC827/ER cells the cells were co-cultured with exosomes of the si-NC, si-circRNA_102481, and miR-30a-5p NC, miR-30a-5p inhibitor using RT-qPCR and western blot assay, respectively. ( C ) IC50 of gefitinib or erlotinib the cells were co-cultured with exosomes of the si-NC, si-circRNA_102481, and miR-30a-5p NC, miR-30a-5p inhibitor was detected by MTT assay. * p < 0.05, ** p <0.01.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Cell Culture, Quantitative RT-PCR, Western Blot, MTT Assay

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Large sample validation and correlation analysis. ( A – C ) RT-qPCR analysis of exosomes circRNA_102481, exosomes miR-30a-5p, exosomes ROR1 mRNA before and after EGFR-TKIs resistance in 58 NSCLC patients. ( D , E ) Pearson’s correlation analysis of between exosomes circRNA_102481 and exosomes miR-30a-5p, between exosomes miR-30a-5p and exosomes ROR1 mRNA.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Biomarker Discovery, Quantitative RT-PCR

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Relationship between exosomes circRNA_102481-miR-30a-5p-ROR1 axis with clinicopathological variables. ( A ) exosomes circRNA_102481, ( B ) exosomes miR-30a-5p, ( C ) exosomes ROR1 mRNA.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques:

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Kaplan-Meier PFS curve stratified by exosomes circRNA_102481- miR-30a-5p-ROR1 axis expression. PFS duration between higher and lower ( A ) exosomes circRNA_102481, ( B ) exosomes miR-30a-5p, ( C ) exosomes ROR1 mRNA.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Expressing

Journal: Aging (Albany NY)

Article Title: Tumor-derived exosomal circRNA_102481 contributes to EGFR-TKIs resistance via the miR-30a-5p/ROR1 axis in non-small cell lung cancer

doi: 10.18632/aging.203011

Figure Lengend Snippet: Kaplan-Meier OS curve stratified by exosomes circRNA_102481- miR-30a-5p-ROR1 axis expression. OS duration between higher and lower ( A ) exosomes circRNA_102481, ( B ) exosomes miR-30a-5p, ( C ) exosomes ROR1 mRNA.

Article Snippet: The exosomes RNA of five pair’s samples was extracted using RNeasy Mini Kit (Qiagen GmbH) and the circRNA profile was measured using Arraystar high-throughput human circRNA microarray V2.0 (8x15 K; Arraystar, Inc.).

Techniques: Expressing

Journal: BioMed Research International

Article Title: MicroRNAs-mRNAs Expression Profile and Their Potential Role in Malignant Transformation of Human Bronchial Epithelial Cells Induced by Cadmium

doi: 10.1155/2015/902025

Figure Lengend Snippet: Targets of DEGs. (a) Venn diagrams showing the unique and shared regulated targets in DEGs; (b) showing the networks of 214 microRNA-mRNA interaction pairs of three of the databases.

Article Snippet: In order to identify and study differentially expressed mRNAs and miRNAs after cadmium exposure, miRCURY LNA 7th miRNA chip and the Human mRNA Array v2.0 (8 × 60 K, Arraystar) were simultaneously used for high-throughput screening.

Techniques:

Journal: BioMed Research International

Article Title: MicroRNAs-mRNAs Expression Profile and Their Potential Role in Malignant Transformation of Human Bronchial Epithelial Cells Induced by Cadmium

doi: 10.1155/2015/902025

Figure Lengend Snippet: Combinational analysis in the data of microRNA and mRNA microarray.

Article Snippet: In order to identify and study differentially expressed mRNAs and miRNAs after cadmium exposure, miRCURY LNA 7th miRNA chip and the Human mRNA Array v2.0 (8 × 60 K, Arraystar) were simultaneously used for high-throughput screening.

Techniques: Microarray

Journal: Frontiers in Oncology

Article Title: SNHG9, a Papillary Thyroid Cancer Cell Exosome-Enriched lncRNA, Inhibits Cell Autophagy and Promotes Cell Apoptosis of Normal Thyroid Epithelial Cell Nthy-ori-3 Through YBOX3/P21 Pathway

doi: 10.3389/fonc.2021.647034

Figure Lengend Snippet: Identification and expression of PTC cell exosome-enriched lncRNA SNHG9. (A) High-throughput screening identification of PTC associated exosome lncRNAs. SNHG9 is PTC cell exosome-enriched lncRNA in TPC-1 and K-1 cells compared with Nthy-ori-3 cell. (B, C) Validation of SNHG9 overexpression in both TPC-1 and K-1 cells and their respective exosomes compared with Nthy-ori-3 cell and its exosome by qPCR. (D) Coregulation network of SNHG9 with mRNA/miRNA. SNHG9 had an interaction with autophagy related molecules. (E) Gene ontology enrichment analysis showed the highest regulation scores in autophagy and apoptosis. (F) KEGG-pathway-weighted analysis showed SNHG9 mainly targeted apoptosis and autophagy pathways. (G) SNHG9 in the PTC cell supernatant mainly derived from cell exosomes. QPCR showed significantly lower SNHG9 expression level in supernatant treated with Rnase and Triton compared with supernatant treated with only Rnase and control group. (H) QPCR confirmed no SNHG9 expression in cell supernatants after exosome extraction. (I) SNHG9 expression level between tumor and normal tissues in 70 PTC patients from FUSCC. The results were normalized to β-actin mRNA level. (J) Waterfall plot showed the distribution of SNHG9 expression level in each PTC patients from FUSCC. ***P < 0.001, data were pooled from three independent experiments. FUSCC, Fudan University Shanghai Cancer Center; PTC, papillary thyroid cancer.

Article Snippet: Next, we used the Arraystar Human LncRNA Array v2.0 gene chip to compare expression profile data of lncRNAs in Nthy-ori-3, TPC-1 and K-1 cells and their respective exosomes.

Techniques: Expressing, High Throughput Screening Assay, Biomarker Discovery, Over Expression, Derivative Assay, Control, Extraction